Protein Synthesis and Words (lesson/class activity)
by Lynn Marie Wartski
Type of Activity:
handsÐon, simulation, review/reinforcement, group/cooperative learning
Target Audience:
Life Science /Biology
Abstract:
Activity will help students to learn or display understanding of the process of protein synthesis.
Materials:
- 20 DNA Template Cards: these will be kept on your desk at all times. After all, DNA cannot leave the nucleus.
- 64 AntiÐCodon Cards: These will be taped to the wall around your room.
- Paper: to write down the mRNA strand and the tRNA molecules and the sentence.
- Pen/Pencil
Procedures for the Teacher:
- Make up all the DNA Template Cards and the AntiÐcodon/word cards--See below for instructions.
- Hang up the AntiÐcodon word cards, so the antiÐcodons are showing.
- Show the student the cards and tell them what they are.
- Tell the students that your desk is the nucleus and the DNA templates cannot leave the area.
- A student is to pick up a DNA template card, write down the DNA template card number, and transcribe it into mRNA.With the mRNA sequence, s/he will go back to the group's desk and the ribosomal student will write out the tRNA antiÐcodon sequence.
- The tRNA student will search out the correct antiÐcodon card and flip the card over revealing the word. S/he will write down the word.
- After completing the sentence, a student in the group will tell you his/her group sentence. If not correct, have the group go over the same DNA template. If correct, have the students pick another card.
Note: Students may work alone or in groups (it is better to assign one student to be the mRNA, another student to write down the anticodons (ribosome) and the third student to search out the proper words (tRNA). Every sentence must have a start (ATG) and a stop (TAG) codon.
Keys for making cards:
*Key to tRNA Cards with Words (Note: write the anticodon on one side of the card, and write the word on the other):
UAG = Stop (period) CCG = is CGC = water
AUG = Initiator (Start) CCU = subject CGG = every
AAA = Your CGA = drink CGU = day
AAC = mother . . . AAG = wears . . . AAU = dresses
ACG = funny . . . ACC = have . . . ACU = dog
ACA = breath . . . AGA = the . . . AGG = are
AGU = Beatles . . . AGC = best . . . AUA = rock
AUC = band . . . AUU = an . . . CAA = old
CAC = rubber . . . CAG = breaks . . . CAU = pulled
CCA = when . . . CCC = Biology . . . CUA = I
CUC = love . . . CUG = roll . . . CUU = music
GAA = all . . . GAC = demented . . . GAG = puppies
GAU = and . . . GCA = so . . . GCC = much
GCG = fun . . . GCU = education . . . GGA = door
GGC = to . . . GGG = future . . . GGU = father
GUA = a . . . GUC = dress . . . GUG = brother
GUU = nothing . . . UAA = we . . . UAC = in
UAU = this . . . UCA = together . . . UCC = must
UCG = be . . . UCU = informed . . . UGA = around
UGC = you . . . UGG = read . . . UGU = little
UUA = DNA . . . UUC = code . . . UUG = for
UUU = life
*Key to DNA Fragments (write these sequences on cards):
- ATGAAAAACAAGGTACACATCTAG
- ATGAAAAACAATTGCACGTAG
- ATGTAAACCACTACATAG
- ATGAGAAGTAGGAGAAGCATAATCTAG
- ATGATTCAACACATCCAGCCACATTAG
- ATGCCCCCGAGAAGCCCTTAG
- ATGCGACGCCGGCGTTAG
- ATGCTACTCATAGATCTGCTTTAG
- ATGTAAAGGGAAGACGAGTAG
- ATGCCCCCGGCAGCCGCGTAG
- ATGGCTCCGAGAGGAGGCAGAGGGTAG
- ATGAAAGGTAAGGTAGTCTAG
- ATGAAAGTGAAGGTTTAG
- ATGTAAAGGGAATACTATTCATAG
- ATGTAATCCTCGTCTCGGCGTTAG
- ATGATAGATCTGCTTCCGAGAAGCTAG
- ATGCCCCCGGAATGATGCTAG
- ATGTGGGTATGTCGGCGTTAG
- ATGTTACCGAGATTCTTGTTTTAG
- ATGTTATCCTCGTGGTTGTTTTAG
Key for the sentences
*20 Sentences:
- Your mother wears a rubber band.
- Your mother dresses you funny.
- We have dog breath.
- The Beatles are the best rock band.
- An old rubber band breaks when pulled.
- Biology is the best subject.
- Drink water every day.
- I love rock and roll music.
- We are all demented puppies.
- Biology is so much fun.
- Education is the door to the future.
- Your father wears a dress.
- Your brother wears nothing.
- We are all in this together.
- We must be informed every day.
- Rock and roll music is the best.
- Biology is all around you.
- Read a little every day.
- DNA is the code of life.
- DNA must be read for life.
Method of Evaluation:
Students are graded on accurate sentence building from the DNA code, and proper execution of sequence of protein synthesis process.
Extension and Reinforcement:
Mistakes are happy events in this activity. Students can see first hand the raw material for mutation and evolution when they come up with sentences that are not correct. These can easily be referred to when discussing variation and change in a population.
|
View Activity Description
